Translate this wildtype mRNA to a protein Start with the tra

Translate this wild-type mRNA to a protein. Start with the translation initiation codon AUG. 5\'.ACAUGAUUACUGCACAUUAAGUGGCUGAC-3 Create a frameshift mutation by inserting an A residue after the first G residue of the wild-type mRNA, write the mutant mRNA sequence below, and translate this mutant mRNA to a protein. Insert a triplet GUU after the first G residue of the wild-type mRNA, write the mutant mRNA sequence below, and translate this mutant mRNA to a protein. Explain why the insertion of three base GUU probably has a milder effect on function of this gene than the one created by the insertion of an A residue with ONE sentence.

Solution

Step 1.

The wild type mRNA:

5\'- ACAUGAUUACUGCACAUUAAGUGGCUGAC -3\'

After translation the polypeptide chain obtained is

Met - Ile - Thr - Ala - His

Step 2.

The mutant mRNA after the insertion of A after the first G is:

5\'- ACAUGAAUUACUGCACAUUAAGUGGCUGAC -3\'

After translation the mutant polypeptide chain obtained is

Met - Asn - Tyr - Cys - Thr - Leu - Ser - Gly

Step 3.

The mutant mRNA after the insertion of GUU after the first G is:

5\'- ACAUGGUUAUUACUGCACAUUAAGUGGCUGAC -3\'

After translation the mutant polypeptide chain obtained is

Met - Val - Ile - Thr - Ala - His

Step 4.

Insertion of GUU in the wild type mRNA will lead to addition of an extra amino acid \"Valine\" in the polypeptide chain. Here the amino acids of the functional polypeptide chain are unchanged. So there is lesser probability that effect of the function of this mutant polypeptide will be lost.

But in the other mutant type, where there is an insertion of A after first G of the wild type mRNA,it caused change of the whole reading frame of the mRNA, thereby replacing the amino acids with other amino acids after the insertion. So there is high probability that the functionality of this mutant polypeptide will be lost.