You have to amplify fixed size 35 kb product from isolated g
You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below:
Primer-F: CGTTTCCCGCCTTCAGTTTAGC
Primer-R: CCCGATCTAGTAACATAGATGACACC
a.) Based on protocol we used in class for DreamTaq DNA polymerase design PCR cycling program for amplification of this fragment.
PCR cycling program:
Put the tubes into the thermocycler programmed as follows:
95°C initial denaturation, 2 min (1 cycle)
35 cycles of:
95°C denaturation, 30 seconds
54°C annealing, 30 seconds
72°C extension, 1 min
Final extension:
72°C extension for 5 min (1 cycle)
4°C cool down
Solution
A mixture of Template (Target DNA sequence), primers (single strand oligonucliotide), dNTP’s (dATP, dGTP, dCTP, dTTP), taq DNA polymerase enzyme and buffer solution to keep constant pH. This mixture is introduced in to the thermoclyer. Then we can program it for following sequence of temperature as mentioned in the question to multiply the target DNA sequence.
95°C initial denaturation, 2 min (1 cycle)
35 cycles of:
95°C denaturation, 30 seconds
54°C annealing, 30 seconds
72°C extension, 1 min
Final extension:
72°C extension for 5 min (1 cycle)
4°C cool down

