Translate this wildtype mRNA to a protein Start with the tra

Translate this wild-type mRNA to a protein. Start with the translation initiation codon AUG. Explain.

5\' - ACAUGAUUACUGCACAUUAAGUGGCUGAC - 3\'

Answer: mRNA is read from 5’ to 3’

Starting codon is AUG- codes for methionine

The above mRNA codes for- Met-Ile-Thr-Ala-His-Stop

$Translate this wild-type mRNA to a protein. Start with the translation initiation codon AUG. Explain. 5\' - ACAUGAUUACUGCACAUUAAGUGGCUGAC - 3\'SolutionAnswer: m$

Translate this wildtype mRNA to a protein Start with the tra

Solution

Get Help Now

Submit a Take Down Notice