what is the longest open reading frameorf in the following D

what is the longest open reading frame(orf) in the following DNA sequence?

GGATTGTGATGGAAGGGGTGGTCATGCTGCTCATCGGTCAGCTTTGACATGAGTT

Solution

The longest orf in the given DNA sequence is the ATGGGGTGGTCATGCTGCTCATCGGTCAGCTTTGA . An open reading frame starts with an atg coden and ends with tag, taa tga codons.