Restart your subscription to keep accessing solutions Your C

Restart your subscription to keep accessing solutions. Your Chegg Study subscription will expire on February 24, 2017.CONTINUE MY SUBSCRIPTION

home / study / science / biology / questions and answers / you have to amplify fixed size 3.5 kb product from ...

Your question has been answered

Let us know if you got a helpful answer. Rate this answer

Question: You have to amplify fixed size 3.5 kb product from...

Bookmark

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below:

Primer-F:    CGTTTCCCGCCTTCAGTTTAGC

Primer-R: CCCGATCTAGTAACATAGATGACACC

b.) Based on protocol we used in class for DreamTaq DNA polymerase design PCR cycling program for amplification of this fragment.

Solution

The genomic DNA is used as a template for the PCR amplification of 3.5kb product. The reactions for PCR are genomic DNA template - 50ng

Forward primer 10pm/uL

Reverse primer 10 pm/uL

MgCl2,dNTPS and 1Unit Taq DNA polymerase

The PCR condtions include denaturation, annealing and extension cycles. The annealing temperature need to standadised by checking a amplification of the desired PCR product at different temperature gradient for example temperature range of 50C/52C/54C/56C/58C/60C and higher can be checked

Initial Denaturation - 95 C for 5 min- 1 cycle

Denaturation - 95 C for 30 sec,Annealing temp. for 30 sec,Extension - 72C for 2 min - for 40 cycles

Extension 72 C for 10 min- 1 cycle

4C

The extension time is higher because the PCR product is 3500bp in length