Please answer all of the question I need them to study for a

Please answer all of the question I need them to study for an exam!

You decided to create the first synthetic eukaryote. Its genome has virtually no intron sequences. Here is a region of the genome. The locations of the open reading frames are marked with gray boxes. The arrows indicate the direction of transcription for each gene. The figure above shows a close-up of the DNA strands of the marked region. Mark the template and coding strands. Is the promoter to the left or to the right of GeneX? Is the polymerase moving to the left or to the right? Transcription starts at one of the two bases marked with asterisks (*). Write out the bases of the newly formed mRNA strand. Mark the 5\' and 3\' ends. Translate your newly formed mRNA strand (starting with the 5\'AUG 3\') using the single-letter amino acid abbreviations from the codon table. If you have done everything correctly, you will get a confirmation message spelled out in the amino acids.

Solution

A. for gene \"x\", template strand is 5\' TAA---------------------------TCTA 3\'

                   coding strand is 3\' AATT----------------------------AGAT 5\'

B.The promoter is at the 3\' end of the template strand i.e., at the right side of gene \"X\" because transcription always starts from 3\'-end to the 5\'-end.

C.The polymerase move from right to left i.e., from 3\' to 5\' to form a mRNA complementary to template strand and corresponds to coding strand.

D.The newly formed mRNA is 5\' UCGAUGAGGAUUGGCCACACUUAA 3\'

E. Protein strand: met arg ile gly his thr

single letter code : M R I G H T i.e. m right.