DNA visualizations and forensics The gene that causes cardia

DNA visualizations and forensics.

The gene that causes cardiac dysplasia when mutant has not been identified.

The gene that causes cardiac dysplasia when mutant has not yet been identified. However, the gene is thought to be linked to an STR called INT3. The INT3 STR is comprised of a series of CATA repeats. There are 3 different alleles of this STR that differ in size: A, B, C. Examples of this region of DNA are shown below. INT 3 Allele A CATACATACATACATACATACATACATACATACATACATA- INT 3 Allele B CATACATACATACATACATA Write the definition of an STR here. Include the possible relationship between an STR and a gene. The third allele of INT3 (c) has 8 repeats. Label the alleles (A-c) on the gel below at the approximate places where you see bands. The gel shows PCR products of the INT3 STR. Individuals l-1 ll-4 and Il-5 are affected by cardiac dysplasia. What is the allele of the INT3 STR that is most likely associated with the disease allele causing cardiac dysplasia? What is the most likely explanation for why ll-2 and ll-3 only have one band on the gel? Why is it a thicker band?

Solution

1)STR is short tandem repeat and it is a method used to compare specific loci on DNA from two or more samples.It is a microsatellite consisting two to thirteen nucleotides repeated hundred of times in row in a DNA strand.

The band\'s are thick because lanes are overloaded with too much DNA

For rest of the questions I will answer