The following DNA sequence from 5end to 3 end is for actin g

The following DNA sequence, from 5\'end to 3\' end, is for actin gene. Your goal is amplifying the following sequence and insert the sequence into the Sail and Hindlll sites of the MCS of pET x6HN-N vector. Design forward and reverse primers by following the protocol that we have learned in the lab. Please discuss whether you need to have start codon, ATG, and stop codon (TAG), in the forward and reverse primers, respectively.

Solution

The forward primer with Sall restricitonn site will be - 5\' - GTCGAATGCATTCTGGTATCTTCTAGCGCTTGC -3\'

The reverse primer with Hindiii site will be - 5\' AAGCTTTTAGAAACACTTGTGGTG-3\'

The sequence already contains start and stop codon hence it is not rquired to incorporate start and stop codon in the sequence for the gene.

 The following DNA sequence, from 5\'end to 3\' end, is for actin gene. Your goal is amplifying the following sequence and insert the sequence into the Sail and

Get Help Now

Submit a Take Down Notice

Tutor
Tutor: Dr Jack
Most rated tutor on our site