1 Finding the most likely open Reading Frame ORF A Use the s

1. Finding the most likely open Reading Frame (ORF A. Use the single sequence below (repeated for ease of labeling) to draw in each of three possible reading frames. Reading frame 1: 5 TCGAATGCGAAAATGATTGGATGTAATAATGTC..................................CCCTAGC 3\" Reading frame 2: 5 TCGAATGCGAAA ATGATATGTTGTAATAATGTC.............................ccCTAGC 3\' Reading frame 3: 5 TCGAATGCGATAATGATATGTTGTAATAATGTC.................................CCCTAGC 3\' B. What is the most likely ORF based on what you found above? C. Translate the sequence of the most likely ORF into the resulting amino acid sequence: 2. Nucleotide BLAST to determine a nment Hit Name E-value Query coverage 20% Ambystoma maculatum 5.4 Rana capito 70% Axe 6xe-126 45% Alligator mississippiensis Terrapene Carolina 69% 1xe-06 Nerodia cyclopion 58% 3xe-02. 10% Caretta caretta 9.9 A. What is the single best hit, and how do you know? B. Why might the query coverage be important to consider?

Solution

1)

SEQUENCE 1

TCGAATGCGAAAATGATTGGATGTAATAATGTC.........................CCCTAGC 3’

The 3 possible reading frames are

5\'3\' Frame 1

tcgaatgcgaaaatgattggatgtaataatgtc

S N A K M I G C N N V   

5\'3\' Frame 2

tcgaatgcgaaaatgattggatgtaataatgtc

R M R K - L D V I M     

5\'3\' Frame 3

tcgaatgcgaaaatgattggatgtaataatgtc

   E C E N D W M - - C  

Frame 1 translates into an open reading frame with the protein sequence as follows   SNAKMIGCNNV

M is the initiation codon, the point where the protein synthesis starts

SEQUENCE 2

TCGAATGCGAAAATGATATGTTGTAATAATGTC.........................CCCTAGC 3’

5\'3\' Frame 1

tcgaatgcgaaaatgatatgttgtaataatgtc

S N A K M I C C N N V   

5\'3\' Frame 2

tcgaatgcgaaaatgatatgttgtaataatgtc

R M R K - Y V V I M     

5\'3\' Frame 3

tcgaatgcgaaaatgatatgttgtaataatgtc

   E C E N D M L - - C  

Frame 1 translates into an open reading frame with the protein sequence as follows SNAKMICCNNV

M is the initiation codon, the point where the protein synthesis starts.

SEQUENCE 3

TCGAATGCGATAATGATATGTTGTAATAATGTC.........................CCCTAGC 3’

5\'3\' Frame 1

tcgaatgcgataatgatatgttgtaataatgtc

S N A I M I C C N N V   

5\'3\' Frame 2

tcgaatgcgataatgatatgttgtaataatgtc

R M R - - Y V V I M     

5\'3\' Frame 3

tcgaatgcgataatgatatgttgtaataatgtc

   E C D N D M L - - C   

Frame 1 translates into an open reading frame with the protein sequence as follows SNAIMICCNNV

M is the initiation codon, the point where the protein synthesis starts

3) GLUT 4 is a glucose transported protein. GLUT 4 gene expression increased in fed mouse when compared to fasted mouse.

UCP is mitochondrila uncoupling protein. It is known to mitochondria against lipid-induced oxidative stress. When fatty acid supplies to mitochondria exceed their oxidation capacity, the gene expression levels are increased. Hence in fasting conditions this gene is higher as Beta oxidation of fattyacids occur in mitochondria, this gene is expressed at a higher level.

 1. Finding the most likely open Reading Frame (ORF A. Use the single sequence below (repeated for ease of labeling) to draw in each of three possible reading f
 1. Finding the most likely open Reading Frame (ORF A. Use the single sequence below (repeated for ease of labeling) to draw in each of three possible reading f

Get Help Now

Submit a Take Down Notice

Tutor
Tutor: Dr Jack
Most rated tutor on our site