A doublestranded DNA molecule only the top strand is depicte
     A double-stranded DNA molecule (only the top strand is depicted) was broken by exposure to X-rays at the sites indicated by the vertical lines. If the DNA fragment between the breaks was inverted before the double strand breaks were repaired, what would be the sequence of this strand after repair?  5\' TAAGCGTAA|CGTATCGCAAC|GGGTCCTATTAA 3\'  Write answer here: 5\'  3\' 
  
  Solution
The sequence of the strand after repair would be..
5\'TAAGCGTAACAACGCTATGCGGGTCCTATTAA 3\'

