You have a plasmid that consists of 8400 nucleotide base pai

You have a plasmid that consists of 8400 nucleotide base pairs (bp). You will use the restriction endonuclease. Fok 1 to \"digest\" this plasmid. This enzyme has the following recognition sequence: GGATCC. If you assume that the four different nucleotide bases are distributed randomly within DNA, what is the expected number of cut sites for this enzyme within your 8400 bp plasmid? 1 2 3 4

Solution

Restriction endonuclease Fok I digests the phosphodiester backbone at specific sites in a DNA sequence. By \"specific\" it means that an enzyme will only digest a DNA molecule by locating a particular sequence. i.e, GGATCC

In above case, enzyme Fok I searches for the specific sequence GGATCC in double-stranded DNA and once it is identified, it digests the phosphodiester backbone in two specific places - between the pair of G nucleotides on each strand. That leaves with a four nucleotide single stranded 5\' end on each side after separation.

            In reality there are more than six nucleotides on each strand, of course. The enzyme identifies the specific sequence it\'s interested in, and will accept no substitutes:

GAGGATACCACCAGGGTTACAGGATAGGAGTCAGGATCCAGAGGACCTAGGATACCTC

CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAGGTCTCCTGGATCCTATGGAG

is digested by Fok I to give two fragments of DNA. Hence the answer is B) 2