Which one of the following oligonucleotides would base pair

Which one of the following oligonucleotides would base pair with this sequence? GATCCATACGATACTGATTCAGAAATTTCCATACTAGACATCATATTCGACTTCAAATTGG

I know it will be TTTGAAG but I don\'t understand why? Please explain why this answer is right.

Both the sequences are provided in 5\' to 3\' direction, In a DNA the complementary base pair binds in anti-parallel direction hence this option is correct.