You have identified a sequence of bases that corresponds to

You have identified a sequence of bases that corresponds to the regulatory protein for lactase. Here is part of that dsDNA sequence: 1 5’-TTGGAGTCGGATCCTTACTGCAGAATTTGCTTACGCGCTATTACTCGTTA 3’-AACCTCAGCCTAGGAATGACGTCTTAAACGAATGCGCGATAATGAGCAAT 51 AAGGCTATCTACGATCAAATTTCCGATAGCTAGACCTTAGCTACTAGATC TTCCGATAGATGCTAGTTTAAAGGCTATCGATCTGGAATCGATGATCTAG 101 GGCGATAGCTAGATCGCGCGATAGCGATAGCTAGACTCCCTTAGAAATC CCGCTATCGATCTAGCGCGCTATCGCTATCGATCTGAGGGAATCTTTAG 151 TACTAGCTAGGGATCCTAGCTAGATCCCTAGAAGCTAGGGCTAGTGTGC ATGATCGATCCCTAGGATCGATCTAGGGATCTTCGATCCCGATCACACG 201 AGAACACAGTAGCTCCGGATAGCTAGATCGGCGCGATAAATTATAGATC TCTTGTGTCATCGAGGCCTATCGATCTAGCCGCGCTATTTAATATCTAC 251 GATAGTAGCCGTAAAGCTCGCGCGACGATAAGCTTCTAATCGATTTACG-3’ CTATCATCGGCATTTCGAGCGCGCTGCTATTCGAAGATTAGCTAAATGC-5’ (2 points) Identify two restriction endonucleases that could be used to make sticky ends near the 3’ end of this DNA sequence (upper strand) so that it could be incorporated into a new plasmid. You have a short list of them in Table 9-2, and the specific, short sequences of bases that other enzymes cut at are easily obtained from web resources. You must cut as near to the end as possible and you want two different endonucleases. Indicate the specific sequences of bases for each endonuclease using highlighting or underlining, and name the specific endonucleases.

6. You have identified a sequence of bases that corresponds to the regulatory protein for lactase. Here is part of that dsDNA sequence: 1 5\' TTG GAGTCGGATCCT TACTGCAGAATT CTCGTTA. TTTGCTTACGCGCTATTA 3\' -AAC CTCAGCCTAGGAATGACGTCTTAAACGAATGCGCGATAATGAGCAAT 51 AAG GCTATCTACGATCAA ATTTCCGATAGCTA GACCTTAGCTACTAGATC TTCCGATAGATGCTAGTTTAAAGGCTATCGATCTGGAATCGATGA TCTAG 101 GGCGAT AGCTAGATC GCGCGAT AGCGATAGCTAG TC CCGCTATCGAT CTA GCGCGCTATC (GCTAT CGATCTGAGGGAATCTTTAG 151 TAC TAGCTAGG GAT CCTAGCTA GATCCCTAGAA(GCTAG GGCTA GTGTGC ATGATCGAT CCCTAGGATCGATCTAGGGAT CTTC GATCCCGAT CACACG 201 AGAACACAGTAGCTCCGGATAGCTAGATCGGCGCGATAAATTATAGATC. TCT TGTGTCATCGAGGCCTATCGAT CTA GCCGCGCTATT TAATAT CTAC 251 GATAG TAGCCGTAA.AGCTCGCGCGACGATAAGCTTO TAATCGATTTACG-3\' CTAT CATCGGCATTTCGAG CGCGCTGCTAT TCGAAGATTAGCTAA ATGC-5\' (2 points) Identify two restriction endonucleases that could be used to make sticky ends near the 3\' end of this DNA sequence (upper strand) so that it could be incorporated into a new plasmid. You have a short list of them in Table 9-2, and the specific, short sequences of bases that other enzymes cut at are easily obtained from web resources. You must cut as near to the end as possible and you want two different endonucleases. Indicate the specific sequences of bases for each endonuclease using highlighting or underlining, and name the specific endonucleases

Solution

From 281 to 286 there is one restriction site, which is specific to Hind-III and the sequence is A A G C T T. This sequence is polyndromic un nature and recognised by Hind-III and produce Sticky or Staggered or Cohessive ends. Sticky ends are favourable for easy litigation.

From 291-294 there is another restriction site that is cleaved by Taq-1. The sequence recognised by this enzyme is TCGA and give sticky ends