5 Assuming you could use primers of four nucleotides write t

5. Assuming you could use primers of four nucleotides, write the sequences of the two primers (specify the 5’ and 3’ ends) that should be used to amplify the segment of DNA shown below by polymerase chain reaction - only one strand of the double-stranded DNA is shown.

5\'-G-A-T-T-C-A-G-C-T-A-C-C-G-G-A-C-G-A-T-C-G-C-T-A-G-C-3\'

Solution

The given 5\' - 3\' sequence is 5\'- GATTCAGCTACCGGACGATCGCTAGC - 3\'

Hence complementary strand of this ssDNA is 3\'-CTAAGTCGATGGCCTGCTAGCGATCG- 5\'

Therefore the double-stranded molecule looks something like this

5\'- GATTCAGCTACCGGACGATCGCTAGC - 3\'

3\'-CTAAGTCGATGGCCTGCTAGCGATCG- 5\'

Now as we know, primers that are used to amplify dsDNA molecules are 18-22 bp long and are complementary to the ends of the DNA sequence. However, this question has asked us to generate primers of length 4 nucleotides only. Hence the two primers are always First primer- Complementary to the first strand, and the Second primer is the reverse complement of the end of the same strand.( Sequence of only one strand of the dsDNA molecule is sufficient to generate primers). Now using given ssDNA sequence

Hence the first primer will be the four base pair complement of the 5\'- 3\' strand that is CTAA.

The second primer will be the four base pair reverse complement of the 5\'-3\' of the same strand that is GCTA

Therefore these are the two hypothetical four base pair primers to amplify this DNA sequence. However, we must keep in mind that given DNA sequence is just 22 base pairs, which is too short to be amplified by PCR and four base pair long primers will most likely not work for the actual reaction. Several additional factors also need to be considered when designing primers between 18 - 22 bp long, such as the closeness of their T_m values ( the closer the T_m values of the two oligonucleotides to each other the better the reaction), ( T_m= melting point, dependent directly on GC content of oligonucleotide) and also we need to check for any secondary structure formation of these oligonucleotides before initiation a PCR. Another important factor is that the T_m of the primer pair should be close to the T_m of the template- if the reaction temperature is too high, there may be misannealing to non-target region and if T_m is too low, it may not anneal at all to the target sequence. These are among the several factors that need to be considered before primer design, which have not been considered here.