You are given the sequence of a gene below You need to desig

You are given the sequence of a gene below. You need to design a forward primer and a reverse primer for this gene. You will introduce an NdeI cut site upstream of your gene, and a XhoI cut site downstream of the gene. Primer length should be between 20-25 bases. You must write the primer sequences from the 5’ à 3’ direction in the space at the bottom of this page. Underline the restriction recognition sequences in your primers (10 pts)

NdeI recognition sequence: CATATG         XhoI recognition sequence: CTCGAG

Forward: ____________________________________________________________

Reverse:_____________________________________________________________

Solution

Forward primers (20 bp)

5\'--->3\'

TTTAGGACAACTACGCCGGG (plus strand)

Reverse primers (20 bp)

3\'---->5\'

CTAGCTAGCTTGGGGCAACA (minus strand)

There don\'t seem to be any restriction sites for the above restriction enzymes in the primer sequences.

You are given the sequence of a gene below. You need to design a forward primer and a reverse primer for this gene. You will introduce an NdeI cut site upstream

Get Help Now

Submit a Take Down Notice

Tutor
Tutor: Dr Jack
Most rated tutor on our site