Quiz https x Inbox X C Secure httpsoregonstateinstructurecom
     Quiz https/ x Inbox X C Secure https://oregonstate.instructure.com/courses/1618657/quizzes/2364147/take/questions/47010910 NetTutor Chegg Media Gallery Question 1b: Bottom Strand ate My Media Given the above segment of DNA, fill in the missing nucleotide bases Nucleotide bases hidden by turns in the DNA have been provided in bold red font. A few additional nucleotide bases have been provided to help you check your work. r Select Select Select l Selec Select Select llu Hall The Mental matlab R2016b wi... exe Hall The Menta pd omework 1 Instr. S w Time Elapsed Hide Attempt due: Jan 21 at 11:59pm 13 Minutes, 3 Seconds  
  
  Solution
The bottom strand in the given DNA double helix has the following nucleotide sequence:
3\'TACCCCGCCCTCCGATGGACCGTTGCATTC5\'
Note: The nucleotides marked in bold are the ones provided to be hidden in the turns.

