NOTE Please replace deoxythymidine in the above problem wwit

****NOTE: Please replace \"deoxythymidine\" in the above problem wwith \"dideoxythymidine\"

How many fragments of DNA will result and what are their sequences, when using deoxythymidine triphosphate to sequence this fragment of gene? Give the primer sequence. Sequencing occurs on the indicated strand. 3\' AGTCACTGTTCGGCTAGTGCATGGTCG 5\' 5\' TCAGTGACAAGCCGATCACGTACCAGC 3\'

Solution

---> 5\' TCAGTGACAAGCCGATCACGTACCAGC 3\'

Forward primer in 5\'-->3\' direction. Primer is in 5\'-->3\' direction on the indicated strand
        5\'AGTCACTGTTCGGCTAGTG3\'caddttp

Here, since ddTTP is added, when the ddTTP gets incorporated in the primer sequence and wherever it finds a complementary C residue, the sequence will be terminated. Thus , only one sequence will be formed and the chain will be terminated as soon as the ddTTP is incorporated since it lacks a 3\'OH group, also known as chain termination reaction.
The sequence is as follows:
5\'AGTCACTGTTCGGCTAGTGCAddttp

****NOTE: Please replace \

Get Help Now

Submit a Take Down Notice

Tutor
Tutor: Dr Jack
Most rated tutor on our site