For the following mRNA sequence what is its 5 UTR Its 3 UTR

For the following mRNA sequence what is its 5 UTR? Its 3 UTR? What protein sequence does it translate to? Use the standard genetic code for the translation.

ACTTGTCATGGTAACTCCGTCGTACCAGTAGGTCAGTG

Please give me some explanation on how to get the answer

Solution

3\' ACTTGTCATGGTAACTCCGTCGTACCAGTAGGTCAGTG 5\'...Template DNA

5\' UGAACAGUACCAUUGAGGCAGCAUGGUCAUCCAGUCAC 3\'.....mRNA

5\' ................5\'UTR..........................AUG/GUC/AUC/CAG/UCA/C............stop....3\'UTR........... 3\'

Protein will be: Met Val Ile Gln Ser

Explanation: The sequence in the question cannot be mRNA as t has T in place of U.So it can be considered as a template DNA strand i.e 3\' to 5\'.Write down the complementary sequence from 5\' to 3\' to give mRNA.mRNA translation begins with first AUG as start codon from 5\' end.The sequence before AUG or start codon makes the 5\'UTR region and the sequence after the stop codon in the 3\' end makes the 3\'UTR.Since stop codons are missing in the 3\' end assume a stop codon and the sequence after that will be 3\'UTR.Next, corresponding to the codons, specify the aminoacids.

For the following mRNA sequence what is its 5 UTR? Its 3 UTR? What protein sequence does it translate to? Use the standard genetic code for the translation. ACT

Get Help Now

Submit a Take Down Notice

Tutor
Tutor: Dr Jack
Most rated tutor on our site