Given this gene sequence ACCGGGAAGCGTGAACTACATCTCCCAGGG Plea

Given this gene sequence

ACCGGGAAGCGTGAACTACATCTCCCAGGG

Please answer/explain the following questions

1. Identify the gene from which the query sequence originates (Name of gene)

2. Provide the FULL protein sequence encoded by the gene.

3. Are different splice variants known for this gene?

4. What human disease has been connected to this gene?

5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.

6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference

7. Are there homologues for the identified gene in other systems? Identify onehomologue in a invertebrate system (if there is none, provide a vertebratehomologue).

8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease etc.) of the protein(s) encoded by the gene.

9. Generate a FULL protein sequence alignment for one of the identified putativeprotein products with at least one similar invertebrate protein (if there is none, use avertebrate homologue).

10. Generate a secondary structure prediction for one identified protein.

Solution

This question has multiple questions. Asker ddi not specify which out of multiple questions need to be answered. As per Chegg\'s policy, I am answering first 4 questions.

1) This gene is KLHL24. This can be found by searching this sequence in NCBI blast.

2) It is a 600 aminoacid protein. Protein sequence (reading from Aminoi terminal to corboxy terminal) in sigle letter aminoacid codes was given below. This is retrieved from ensembl genome database.

3) There are splice variants for thios gene. Please see the attached figure showing all known/predicted transcripts of this gene.

Transcript KLHL24-003 has 9 exons in total whereas KLHL24-001 has 8 exons. Exon 2 of KLHL24-003 transcript is spliced in KLHL24-001 transcript.

4) This gene is associated with Epidermolysis bullosa simplex syndrome. This information can be retrieved from OMIM database.

5) pI is 5.98 and protein molecular weight is 68361.24 Daltons. This can be calculated manually, but it is cum,bersome. It is easy to use an online server lioke expasy to do this calculation.

6) Reference of a recent publication:

He, Y., Maier, K., Leppert, J., Hausser, I., Schwieger-Briel, A., Weibel, L., Theiler, M., Kiritsi, D., Busch, H., Boerries, M. and Hannula-Jouppi, K., 2016. Monoallelic Mutations in the Translation Initiation Codon of KLHL24 Cause Skin Fragility. The American Journal of Human Genetics, 99(6), pp.1395-1404.