DECODING THE FLU You are worried You have landed a summer in

DECODING THE FLU You are worried. You have landed a summer internship at the National Center for Preparedness, Detection, and Control of Infectious Diseases (NCPDCID). It didn\'t pay, but it helped boost your resume before applying to medical school. Your bossalso let you tag along on a CDC research trip to rural Mexico. However, what had appeared to be a wonderful opportunity didn\'t seem so great when the team contracted one of the flu viruses they had been studying. So far, you were the only one other than the team leader, Dr. Phillips, who was not sick. Earlier that morning, Dr. Phillips had told you she had a job for you. \"Normally, I would give this to a senior staffer, but they\'re all sick. We think there may be a problem with the flu virus the team has caught I\'ll be right back with your assignment.\" Dr. Phillips came back a few minutes later. Here is the situation. The team appears to have contracted an atypical flu virus. For starters, the symptoms are worse than usual and even healthy adults are getting severely Also, none of the team\'s vaccinations protected them from this virus, We\'re worried that we are dealing with a new strain of influenza we haven\'t seen before. We need to figure out ho this virus is different. The hemagglutinin (HA) helps the flu virus infect cells and the structure of this protein can vary in different virusstrains.I want you to compare the HA gene for the different strains of the virus the team was examining with a typical flu virus. Because we don\'t have power right now, you will have to do this the old-fashioned way with pencil and paper. Here is the nucleotide sequence for a typical HA g You can start by finding the coding region for the gene.\" Dr. Phillips returned with a sheet of paper. \"Without computers, all have been able to find so far is a partial sequence believe is at the beginning of the HA g Start by finding the coding region. 1. Transcribe the DNA sequence to obtain the mRNA transcript Partial DNA sequence: ATTGGTACTTCTGATAGTAAACGAAACTCGATGTAAG mRNA: You recall that the coding sequence within the gene would start with an mRNA START codon (AUG) and that codons occur in sets of three bases which provides the re frame. 2. ldentify the mRNA start codon AUG and thereby determine the correct reading frame for the mRNA. Then transcribe the mRNA, starting with the start codon which codes fo the amino acid methionine (MET (use the 3-letter abbreviations using the Genetic Code on p. 1 HA partial amino acid sequence: Met Lys, Thr lie, lic Ala Leu Se Tyr, lie \"Great You found the start for the HA gene coding region. Here are HA gene sequences the team had collected for the different flu strains that they were studying. We only have information on the start of the gene, but it might be enough unes RNA for eenetic code instead of DNA, researchers aften work with DNA copies leoNAJ of More information for genes as DNA sewences the vrussernes and generaly

Solution

Answer:

1. DNA: ATTGGTACTTCTGATAGTAACGAAACTCGATGTAAG

mRNA: UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC

2. mRNA: UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC (Start codon has been underlined)

Met Lys Thr Ile Ile Ala Leu Ser Tyr Ile

6. Wild type mRNA: UAACC AUGAAGAC    U    AUCAUUGCUUUGAGCUACAUUC

Mutated mRNA (Strain 4): UAACC AUGAAGAC    AUCAUUGCUUUGAGCUACAUUC

The underlined \'U\' in the wild type DNA sequence have been deleted in the mutated mRNA of Strain 4.

So, it is a frameshift mutation due to deletion of a single nucleotide \"U\" from the wild type sequence.

Frameshift mutations arise when the normal sequence of codons is disrupted by the insertion or deletion of one or more nucleotides, provided that the number of nucleotides added or removed is not a multiple of three.

The single nucleotide deletion in strain 4 mRNA causes a frame shift in the overall reading frame, thereby changing the amino acid sequence after the third amino acid, Thr. It also causes a premature termination of translation. Thus, it can be expected that the protein so produced will be non functional.

Translated sequence of mutated mRNA:

Met Lys Thr Ser Leu Leu Stop