Below is a coding sequence of DNA what is the RNA and amino

Below is a coding sequence of DNA, what is the RNA and amino acid sequence produced off of this DNA? 5\' ATTTGCATGTTTCCCTAGTCT 3\' RNA: Amino Acid Sequence:

Solution

The given coding strand is 5^\' ATTTGCATGTTTCCCTAGTCT 3^\'

The template strand will be 3\' TAAACGTACAAAGGGATCAGA 5\'

The mRNA strand will be 5\' AUUUGCAUGUUUCCCUAGUCU 3\'

The tRNA will be UAA ACG UAC AAA GGG AUC AGA UAA is a stop codon.

Since translation takes place from the amino end to carboxyl end that from 5\' to 3\' of the RNA template. so the code for the amino acid that the tRNA will transfer to the mRNA is the STOP codon for the first code only.So the protein synthesis will not take place for the given template and the ribosomes will detach off.