Homework Sourse Homework Sourse

Write the amino acid sequence of the short protein peptide e

Write the amino acid sequence of the short protein (peptide) encoded by the following DNA sequence ACAATTGGATGCCTTTATGCTAGTATAGAATTGC using the correct reading frame and amino acid three letter code table.

Solution

Answer :- Threonine-isoluecine-Glycine-Cystine-leucine-Tyrosine-Alanine-Serine-Isoleucine-Glutamate

Write the amino acid sequence of the short protein (peptide) encoded by the following DNA sequence ACAATTGGATGCCTTTATGCTAGTATAGAATTGC using the correct reading

Get Help Now

Submit a Take Down Notice
Tutor
Tutor: Dr Jack
Most rated tutor on our site