Restriction endonucleases are bacterial e that recognize bin

Restriction endonucleases are bacterial e that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRi which recognizes the 6 bp sequence 5 \'GAATTC 3\' and cleaves the phosphodiester backbone after the G. HinD III (A|AG CTT), BamHI (G|GATCC), PstI (C|TGCAG), NotI (GC|GGCCGC). NdeI (CA|TTATG) EcoRV (GAT^ATC), Clal (AT^CGAT) Find the sites that these enzymes recognize in the following sequence an mark the cut site in colored ink and label on top where the enzyme recognizes and binds. example EcoRI GTCCATGGG bar|AAT TC bar ACTAGCT AGCTCGGACTCATATGATATGCGGCCGCATCGAAATCGATTGAGGTACCATGCTAGATC ATCAAGCTTAATTTACTAGCTGGATCCCATCGATCAGATCTCATCGAGAATTCGACCTA CTG CAGCATTACGATATCCTAGCATCCATTTACGGACTCCCGGGA AGCTT CATGGGTAGCTA3\'

Solution

  NdeI   NotI ClaI KpnI

5’ AGCTCGGACTCA|TATGATATGC|GGCCGCATCGAAATˆCGATTGAGGTACˆCATGCTAGATC

          Hind III BamHI ClaI Bgl II

ATCA|AGCTTAATTTACTAGCTG|GATCCCATˆCGATCAˆGATCTCATCGAGAATTCGACCTA

    PSTI EcoRV XmaI/SmaI

C|TGCAGCATTACGATˆATCCTAGCATCCATTTACGGACTCˆCCˆGGGAAGCTTCATGGGTAGCTA 3’