The Achain of insulin is quite short being only 21 amino aci

The A-chain of insulin is quite short, being only 21 amino acids long. For humans, this sequence is Determine an mRNA sequence that will code for this polypeptide (note that there are several sequences that will give the correct answer).

mRNA sequence that will code for this polypeptide is;

GGUAUUGUUGAACAAUGUACUAGUAUUUGUUCUCUUUAUCAACUUGAGAAUUAUUGCAAU