We are using the Sanger technique of gene sequencing to disc

We are using the Sanger technique of gene sequencing to discover the sequence of bases in a DNA sample. The gel pictured here is the result of the Sanger technique laboratory protocol. The wells of the gel are at the TOP of the picture; that is where the DNA fragments were loaded. Based on the developed gel as shown, give the sequence of the bases in the original DNA sample.

Answer format: All capital letters, no spaces.

Example answer: ATGCATCG

Solution

If we arrange all the nucleotides in 5\' to 3 \' direction, it reads as TACGAAGCCGTTCTGAGTTTTTTAT