If the following error occurred during DNA replication incor
     If the following error occurred during DNA replication (incorrectly added nucleotide shown in boldface and underlined) in humans, would it be better for the error to be fixed by the mismatch repair machinery or the base excision repair machinery? In your answer, clearly describe what would happen in each case.  5 \' GTAACTATGATGGATAGATCGACAGGGGGACGAGTTGGCAAGAGAGACCTTTAGATGAC 3 \'  3 \' CATTGATACTACCTATCTAGCTGTCCCCCTGCTTAACCGTTCTCTCTGGAAATCTACTG 5 \'   
  
  Solution
DNA mismatch repair mechanism is used to repair the error during DNA replication
In DNA mismatch repair mechanism mis-incorporation of bases can be rectified where as in case of base excision repair mechanism the damaged nucleotide is removed & replaced by other matching nucleotide .in the given DNA sequence the there is a mismatch (G-T). There fore DNA mismatch repair mechnism is appropriate one to fix the error

