The partial sequence of one strand of a doublestranded DNA m
     The partial sequence of one strand of a double-stranded DNA molecule is shown below:  5\'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG-3\'  Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above. The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.  How would you go about cloning this fragment into a plasmid? Use a diagram. 
  
  Solution
1 a)
5\'--GACGAAGTGCTGCA^GAAAGTCCGCGTTATAGGCATG^AATTCCTGAGG --3\'
3\'--CTGCTTCACG^ACGTCTTTCAGGCGCAATATCCGTACTTAA^GGACTCC--5\'
After digestion, the product is- 5\'---GAAAGTCCGCGTTATAGGCATG---3\'
3\'-----ACGTCTTTCAGGCGCAATATCCGTACTTAA-----5\'

