1 5 TACGGTCGTTTACGCCTGCCCAATGCGTGC 3 a design primers that c
1)
5’ TACGGTCGTTTACGC------------------------------------CTGCCCAATGCGTGC 3’
a) design primers that can be used in a PCR reaction make each primer 15 nt
b) design a second set of primers that contains an EcoRI restriction site in each primer
Solution
1. a) Sequence of primers using the above neucleotide sequences are:
b) EcoRI restriction site is GAATTC. So, its counterpat CTTAAG must be remain in its primer.
So, primers are:

