1 5 TACGGTCGTTTACGCCTGCCCAATGCGTGC 3 a design primers that c

1)

5’ TACGGTCGTTTACGC------------------------------------CTGCCCAATGCGTGC 3’

a) design primers that can be used in a PCR reaction make each primer 15 nt

b) design a second set of primers that contains an EcoRI restriction site in each primer

Solution

1. a) Sequence of primers using the above neucleotide sequences are:

b) EcoRI restriction site is GAATTC. So, its counterpat CTTAAG must be remain in its primer.

So, primers are: