Certain genes of human papilloma virus are encoded by partia

  Certain genes of human papilloma virus are encoded by partially overlapping reading frames. The following sequence encodes both the 3’ end of the E1 coding region and a portion of the 5’ end of the E2 gene. (Both genes are encoded on the same strand).

The symbol § indicates the first base of a codon in the E1 reading frame, while ¶ indicates the start of a codon in the E2 reading frame. Translate the sequence in both reading frames. Use a genetic code chart from your book or other reliable source.

                 TCAGCTAATGAACATTTATGA

                  §¶

Solution

Answer:

First reading frame, E1:

DNA sequence: TCAGCTAATGAAVATTTATGA (The start codon has been underlined)

Translated sequence: S A N E H L Stop

Second reading frame, E1: TCAGCTAATGAACATTTATGA (The start codon has been underlined)

Translated sequence: Q L Met N I Y

The encoded protein in the E2 reading frame starts with Met.