A research technician wants to insert a section of the follo

A research technician wants to insert a section of the following chromosomal DNA fragment (YFG) into the plasmid below. She decides to digest the fragment with EcoRI and PvuII restriction endonucleases. The restriction enzyme sites in the polylinker region of the plasmid are indicated. The nucleotide number is given next to each restriction enzyme. Assume that these are unique sites such that treatment with a particular enzyme will only cleave the plasmid at the indicted site. The arrows shown on the plasmid DNA are used for transcription purposes only.

Chromosomal DNA (YFG)

5’--- GGTGAATTCAGCTTCGCATTAGCAGCTGTAGC---3’

3’--- CCACTTAAGTCGAAGCGTAATCGTCGACATCG---5’

Plasmid:

A.) Give the sequence of the DNA fragment (5’-3’ coding sequence) generated by treatment with these two enzymes.

B.) Suggest two restriction enzymes that you could use to prepare the plasmid so that YFG could be ligated into the plasmid in the correct orientation (so that the coding strand reads 5’-3’ in a clockwise direction when it is incorporated into the plasmid). Justify your answer.

C.) Bacteria transfected with the recombinant plasmid DNA will be resistant to which antibiotic? Justify your answer.

EcoRI 4361 Clal 23 Hind Ill 29 Aat II 4286 EcoR V 185 Sspl 4170 Nhe l 229 4000 BamHI 375 Sphl 562 Scal 3846 EcoNI 622 Pvul 3735 Sall 651 PshA 1712 Psti 3609 Tetracycline Ap resistance Vspi 3539 Tcr gene (Tcr) Xma III 939 Ampicillin Bsa I 3435 Nrul 972 resistance 1000 Eam1105 3363 gene (Ap) pBR322 -r BspM l 1063 4,363 bp Bsmi 1353 Styl 1369 3000 Ava I 1425 AlwN 2886 Msc I 1444 Or BstAP I 1580 Bsgi 1650 Kpn2 l 1664 Marm 1668 Afl III 2475 BspLU11 Nde 2297 BsaA I 2227 2000 Bst 1107 2246 Esp 312124 Pvull 2066 Tth111 l 2219

Solution

A)

5’--- GGTG^AATTCAGCTTCGCATTAGCAG^CTGTAGC---3’   EcoRI and PvuII restriction

3’--- CCACTTAA^GTCGAAGCGTAATCGTC^GACATCG---5’

5’--- AATTCAGCTTCGCATTAGCAG---3’

3’--- GTCGAAGCGTAATCGTC---5’

B)

In order to prepare the plasmid so that YFG could be ligated into the plasmid in the correct orientation we need to digest the plasmid with EcoRI and PvuII. By doing so, both the gene of interest and the plasmid both will have same sticky ends so that ligation becomes easy.

C) Since our gene fragment will get incorporated in the region where tetracycline resistant gene was present, so now only ampicillin resistant gene is intact. Therefore transformed bacteria will be resistant to ampicillin.

A research technician wants to insert a section of the following chromosomal DNA fragment (YFG) into the plasmid below. She decides to digest the fragment with

Get Help Now

Submit a Take Down Notice

Tutor
Tutor: Dr Jack
Most rated tutor on our site