You isolated small protein X that is important for regulatio

You isolated small protein X that is important for regulation of photosynthesis in bacterium Rhodopseudomonas palustris.

a) Based on the amino acid sequence of protein X provided below, propose the mRNA sequence 5’-3’ direction

Nterm-IMNTESLA-Cterm

b) Provide the corresponding DNA template sequence 5’-3’ direction

c) Propose a single amino acid substitution in the protein X that will result in more hydrophobic protein. Expain.

d) Name experimental procedure by which you would introduce a single amino acid substitution in protein X. Provide a brief description of how this is done.

Solution

The given peptide chain is as following:-IMNTESLA

N terminal - Isoleucine-Methionine-Asparagine-Threonine-Glutamic acid-Serine-Leucine-Alanine- C terminal

So, code for the peptide chain is

AUUAUGAAUACUGAAAGUUUAGCU

mRNA sequence is

UAAUACUUAUGACUUUCAAAUCGA

DNA sequence is

ATTATGAATACTGAAAGTTTAGCT

Substitution of Valine in place of glutamic acid make this protein X more hydrophobic because valine is hydrophobic amino acid and glutamic acid is negatively charged amino acid.

Single base substitution is one of the best way to introduce substitution in the protein X.