Question 1 Consider that the following double stranded DNA i

Question 1) Consider that the following double stranded DNA is your gene of interest and that the bottom strand is transcribed. Please indicate the mRNA sequence that will be generated after transcription of your gene and the polypeptide generated after translation. Label the 5’ and 3’ of the mRNA and the amino (“N”) and carboxyl (“C”) ends of the polypeptide. Use the genetic code table to generate your polypeptide.

DNA:   

5’ A T T G G A T G G C C A T T A T C T G G A A G G A A T A G T T T 3’

3’ T A A C C T A C C G G T A A T A G A C C T T C C T T A T C A A A 5’

a) mRNA:

b) polypeptide:

c) What is the sequence of bases of the anticodon (indicate 5’ and 3’ ends of the anticodon) for the third amino acid of that polypeptide?

d) How many codons are used to produce that polypeptide?

e) How many anticodons are used to produce that polypeptide?

Solution

a) mRNA : 5^l AUUGGAUGGCCAUUAUCUGGAAGGAAUAGUUU 3^l

b) Amino acids : Methionine-Alanine-Isoleucine-Isoleucine--Tryptophan-Lysine-GLutamic Acid

c) 3^l UAG 5^l

d) 8 codons including start and stop codons

e) 6 anticodons